Сдам Сам

ПОЛЕЗНОЕ


КАТЕГОРИИ







Что говорит ДНК-генеалогия о кавказцах





 

Не знаю как кто, а я считаю кавказцев родными и близкими русским людям. Со времен Советского Союза у меня осталось теплое к ним отношение, и я продолжаю с удовольствием смотреть старые их кинофильмы, слушать их песни, как народные, так и эстрадные, и вспоминать свои поездки в их замечательные края в старое доброе время. Да, пробегала между нами кошка, и были поводы обижаться с обеих сторон, но и между братьями ссоры бывают. Среди моих учеников в МГУ и в Академии наук было немало кавказцев, и теплые отношения со многими сохраняются до сих пор.

Но я в данном случае говорю не о духовной близости, а о той, что записана в наших ДНК. И вот здесь выясняется, что мы со многими кавказцами братья весьма далекие. Впрочем, это ясно и при взгляде на антропологию, и на написание знаков письменности, и на звучание языков. И мы, и кавказцы – европеоиды, но если русские по антропологии в подавляющем большинстве принадлежат к центральному европейскому варианту (великорусы; ильменцы; широкоголовые шатены), то кавказцы по известным (и всегда спорным) классификациям расходятся на кавкасионскую, арменоидную, понтийскую и каспийскую антропологию. Здесь, кстати, термин «кавкасионская», или «кавкасоидная» (раса) вовсе не означает «кавказская», и само это название имеет интересную историю. В 1795 году немецкий антрополог Иоганн Фридрих Блуменбах нашел на Кавказе череп, который показался ему верхом совершенства и изящества пропорций. Естественно, он принадлежал европеоиду, такой красивый, кому же еще?

Тот самый «красивый череп» и положил начало термину «кавкасионская раса». По западной классификации, «кавкасоидная раса» эквивалентна «европеоидной». Блуменбах считал, что белый человек, или европеоид, появился изначально на Кавказе, и потому племена, жившие на Кавказе, он считал образцом наиболее чистого и несмешанного типа «белой расы». Так и принялось в научной литературе, а потом и в быту, как «кавкасион» для обозначения людей европейского происхождения, хотя то, что европеоиды произошли на Кавказе, так и осталось недоказанным. Где произошли европеоиды – не ясно. Может, и на Кавказе. Может, в Центральной Европе. Может, на Русской равнине. Надежных данных в науке пока нет.

Так вот, к кавкасионской антропологии на Кавказе относятся, например, горские грузины – сваны, хевсуры, а также осетины, черкесы, лезгины, карачаевцы, аварцы, ингуши, чеченцы, даргинцы, лакцы, кабардинцы – в общем, перечислять придется долго, на Кавказе более 50 народностей. Арменоидная антропология – у армян, ассирийцев и восточных грузин. Понтийская – у абхазов, адыгов и западных грузин. Каспийская – у азербайджанцев.

По языкам кавказцы тоже разнятся – у них и индоевропейские языки, и кавказские, и тюркские. На индоевропейских языках говорят осетины, армяне, курды. На кавказских – грузины (картвельские языки), абхазы и адыги (абхазо-адыгские языки), ингуши и чеченцы (нахские языки), аварцы, даргинцы, лезгины, лакцы (дагестанские языки). На тюркских – азербайджанцы, балкарцы, карачаевцы, кумыки, ногайцы, турки-месхетинцы.



Ясно, что происхождение кавказских народов и народностей должно быть разным, с разной историей, с разными путями миграций. Что на этот счет говорит археология, и как с этим согласуются данные ДНК-генеалогии?

Должен сделать нелегкое заявление. Есть очевидные правила написания статей – либо популярные, либо для специалистов. Они в этих двух случаях пишутся совершенно по-разному. Но это тогда, когда сначала пишет специалист для специалистов, материал устанавливается, обкатывается в профессиональных изданиях, а уж потом, когда-нибудь, он упрощается до популярного изложения. Кому надо разобраться в деталях – пожалуйста, есть профессиональные статьи. Но ДНК-генеалогия развивается столь стремительно, а интерес к ее находкам столь велик, что порой сначала пишутся популярные статьи, а уж потом – профессиональные. Во всяком случае, у меня так обычно и получается.

В данном очерке я объединил оба подхода. Это и есть нелегкое заявление с моей стороны. В первой части идет популярное изложение, и затем оно постепенно начинает переходить в полупрофессиональное, и затем практически в профессиональное. На это я пошел потому, что читатели разные: одним надо просто ознакомиться с материалом, другие требуют ссылок на источники, объяснений, как велись расчеты, как строились деревья гаплотипов, возмущаются, если автор не дает погрешности расчетов в форме стандартных квадратичных отклонений, а это в ДНК-генеалогии важно. Поэтому я попытался написать материал так, чтобы удовлетворить требования и тех, и других. Если расчеты неинтересны, их можно пропускать. Если погрешности расчетов неважны, на них можно не обращать внимания. Если предковые гаплотипы неинтересны и слишком детальны, не обращайте на них внимания. Это же касается ветвей гаплотипов и расчетов по ним.

Но думаю, что если материал будут читать кавказцы, а они читать непременно будут, то они станут углубляться в любые детали, и станут требовать еще. Так что приношу всем извинения – просто любопытным за излишние детали изложения, профессионалам – за недостаточные детали изложения, кавказцам – за то, что так мало поместил деталей о кавказских этносах и их истории. В принципе, у меня есть материал по ДНК-генеалогии Кавказа на сотни страниц, и это притом, что число кавказских гаплотипов очень недостаточно для создания более-менее адекватной картины родов и племен Кавказа с точки зрения ДНК-генеалогии. Все это постепенно будет публиковаться, в том числе в содружестве с археологами, историками, лингвистами. Так что примите это как первую, предварительную попытку дотронуться до ДНК-генеалогии Кавказа.

 

Кратко – об археологии Кавказа

На Кавказе есть множество археологических памятников, но мы кратко остановимся только на древнейших археологических культурах, и потому обычно наиболее дискуссионных. Именно на тех, где ДНК-генеалогия может привнести независимые данные в пользу той или другой версии происхождения археологической культуры. Напомню, что археологические культуры подразделяются по совокупности материальных признаков, которые относятся к одной эпохе и одной территории, и по ним, материальным признакам, датируются – либо радиоуглеродным методом, либо «синхронизацией» с теми, что уже датированы.

Одна из древнейших культур – это северокавказская культура накольчатой жемчужной керамики каменного века с переходом в ранний бронзовый век (6500–5500 лет назад), на территории которой находятся современные Адыгея и Карачаево-Черкессия. Она переходит в Майкопскую культуру раннего бронзового века (6000–5000 лет назад, по другим данным позже, 5200–4300 лет назад), или, как ее часто называют, майкопскую культурную общность, территория которой большой полосой проходит по предгорьям Северного Кавказа от Черного моря до современной Чечни, и соседствует на севере с ямной культурой, на юге – с куро-аракской культурой раннего бронзового века (5500–4000 лет назад). Последняя занимает часть Закавказья и прилегающие территории Ближнего Востока, и является преемницей культуры Тсопи (6500–5500 лет назад), а та, в свою очередь, преемницей культуры Сиони (7000–6000 лет назад). Майкопская культура переходит в северокавказскую культуру бронзового века (примерно 4200–3800 лет назад).

На Западе Грузии и в Армении известна триалетская археологическая культура бронзового века (4000–3500 лет назад), переходящая в колхидскую культуру бронзового и железного веков (3600–2700 лет назад). На Центральном и Западном Кавказе – кобанская культура (3300–2300 лет назад), с ее переходом от бронзового к железному веку. Список археологических культур Кавказа этим далеко не заканчивается, и эти культуры приведены здесь для некоторых исторических иллюстраций.

Надо отметить, что археологи обычно датируют культуры по принципу не «лет назад», а по «до нашей эры». Но поскольку ДНК-генеалогия оперирует хронологией по принципу «лет назад», то приходится для состыковки данных использовать непривычную для археологов хронологическую систему.

Как обычно, пути возникновения археологических культур активно дебатируются. Как, впрочем, и все остальное, связанное с археологическими культурами.

Нередко бывает, что у культур обнаруживаются корни, расходящиеся в разные стороны. Обитатели культур порой сменяли друг друга, причем эти были отнюдь не родственники – это были совершенно разные рода, прибывшие из разных дальних краев. У кавказских культур таких мигрантов было, по меньшей мере, три важных потока, которые иногда шли волнами, на протяжении больших времен. Археологи во многом сходятся на том, что важный миграционный поток шел на Кавказ 7000–6500 лет назад и позже, прибывая из Месопотамии и Ближнего Востока – Сирии, Восточной Анатолии. Этот поток некоторые связывают с прибытием убейдо-урукских традиций и с семитскими языками, но в последнее время его относят к несколько более поздней урукской культуре (примерно 6400–6000 лет назад). С севера шли мигранты степных культур, хвалынской культуры Поволжья (7000–6600 лет назад), азово-днепровской культуры (7200–6800 лет назад) – это, по всей видимости, эрбины, носители гаплогруппы R1b. Позже, примерно 4600–4500 лет назад, с севера прибыли основатели кобанской культуры, и сама культура в том виде, в каком мы ее знаем, сложилась 3300–2300 лет назад. Это, вполне возможно, носители гаплогруппы R1a, с их индоевропейскими языками.

Исследователи привлекают характеристики погребальных обрядов, что рассматривается как одна из наиболее устойчивых особенностей древних культур. Отмечается, что домайкопское население укладывало покойников на спине с подогнутыми ногами, головой на восток; ранние майкопцы клали умерших в скорченном положении – мужчин на правом боку, женщин на левом, головой на юг; позже укладывали головой на запад или юго-запад. Поздние майкопцы, с переходом в северокавказскую культуру, укладывали покойников на спину в вытянутом положении. Это тоже может быть указанием на разные корни майкопской культуры и на разные культуры-наследницы. Если привлечь немногочисленные данные ДНК-генеалогии, то складывается впечатление, что домайкопское мужское население было эрбинами, носителями гаплогруппы R1b, пришедшими с севера. Действительно, в предшествующем абзаце упоминаются мигранты северных степных культур 7200–6600 лет назад, это и есть домайкопские времена. Поздние майкопцы могли быть носителями гаплогруппы R1a, ариями, на их миграционном пути через Кавказ в Месопотамию, Сирию (митаннийские арии), Аравийский полуостров.

Действительно, было отмечено, что носители гаплогруппы R1a в Европе (нынешняя Германия) укладывали покойников-мужчин в скорченном положении на правом боку (головой на запад), женщин на левом (головой на восток), и всех лицом именно на юг (Haak et al., 2008), как и ранние майкопцы. По времени подходит – арии шли через Кавказ на юг примерно 4500–4000 лет назад (Klyosov and Rozhanskii, 2012). Кто укладывал покойников на спину в вытянутом положении – пока неясно, это могли быть носители либо гаплогруппы G2a, либо J2, но могли и R1b. Здесь надо собирать и систематизировать данные. К этому можно отметить, что недавние раскопки на Черноморском побережье современной Болгарии (район Варны), в местах древней добычи соли, с датировками от 7500 до 6500–6200 лет назад, показали трупоположение тех людей в скорченном положении на правом боку (Current World Archaeology, August/ September 2013, vol. 5, No. 12, 24–31), что опять может указывать на носителей гаплогруппы R1a. Правда, недалеко было найдено захоронение, в котором мужчина лежал в скорченном положении на левом боку. Либо похоронные обряды на самом деле были неустойчивыми, что серьезно противоречит основной парадигме археологии, либо второе захоронение не имело отношения к первому, и могло относиться к другой эпохе, другому человеческому роду. Либо, наконец, был перепутан пол костяка в захоронении. Из цитированной статьи это неясно. Рядом – еще одна тройная могила, двое мужчин и одна женщина – все трое в скорченном положении на правом боку, головой к северу. Правда, оба мужчины убиты, черепа пробиты острым предметом. Возможно, чужаки, и потому подлежали другому обряду захоронения?

В отношении майкопской культурной общности было немало гипотез относительно путей ее возникновения – например, предполагалось, что мигранты с юга продвигались на север вдоль Черноморского побережья, и уже значительно позже распространились на восток. Однако радиоуглеродный анализ восточной группы майкопских памятников дал датировки 4540±70 лет назад, 4660±80 лет назад, 4990±120 лет назад (Кореневский, 1993, цит. по Бызов, 2011), что, по мнению некоторых исследователей, показывает синхронность западного и восточного вариантов майкопской культуры. Как пишет И. Бызов (2011), «как бы там ни было, но вопрос о путях миграции майкопцев из Передней Азии на Северный Кавказ остается пока открытым».

Наиболее интригующим является, видимо, прибытие на Кавказ урукской культуры между 7 и 6 тысяч лет назад, представители которой расселились от южного до северного Кавказа, последовательно основав важную археологическую культуру Тсопи (которая также продолжила традиции культуры Сиони), куро-аракскую культуру, майкопскую культуру, и принеся с собой характерные традиции Урука, древнего города-государства, возникшего на территории между современными Багдадом и Басрой в Ираке не позднее 7 тысяч лет назад. Сейчас на месте Урука находится место под названием Варка, и оно практически необитаемо. Река Евфрат давно ушла из этих мест, а когда-то, около пяти тысяч лет назад, в Уруке на территории в 6 квадратных километров жили более 50 тысяч человек (см. журнал Archaeology, сентябрь-октябрь 2013 г., с. 26–32). Тогда это был самый крупный город на Земле, его поздний соперник – Вавилон – возник через две тысячи лет. Урук как город простоял пять тысяч лет, пока не был оставлен из-за ухода Евфрата и соответственно изменившегося климата, коммерческой конкуренции, изменения политической карты тех краев.

Вопрос – почему в те давние времена представители культуры Урука двинулись на Кавказ, притом, как оказалось, чтобы не возвращаться обратно, а поселиться навсегда? Зная красоты Кавказа, последнее неудивительно. Но что привело туда людей с Ближнего Востока? Ответ дают археологи – урукцы пришли на Кавказ за ценными металлическими рудами – медь, серебро, золото, а также, видимо, уходя от перенаселения (Pitskhelauri, 2012, Bulletin of the Georgian Academy of Science, т. 6, № 2, 153–161).

Это очень сжатые представления современных археологических наук. Позже в этом очерке мы примерим на эти представления результаты и выводы ДНК-генеалогии.

Общим является положение, что на Кавказе множество этнических групп, и в каждой долине и на каждом нагорье свои народности, свои языки или диалекты. Это, в общем, верно, но ДНК-генеалогия, которая занимается происхождением родов и племен, неожиданно показала, что родов на Кавказе не так много, всего несколько. Они перемешаны в разных пропорциях в разных этнических группах, что и дало разнообразие, мозаику ДНК-генеалогических линий. Но есть различия и более высокого порядка, и они делят Кавказ практически пополам. Одна половина – западная, в основном гаплогруппа G2a, другая половина – восточная, в основном гаплогруппы J2 и J1, каждая с совершенно разной историей. И во все прослойкой, но в разной степени, порой сходящей на нет, входят гаплогруппы R1a и R1b, каждая опять совершенно со своей, различной историей.

Попробуем в этом разобраться. Но для этого рассмотрим сначала, что такое по сути ДНК-генеалогия.

 

Основные положения ДНК-генеалогии

Здесь речь пойдет о новой науке, которая только создается, основы которой только закладываются в последние годы. Если точнее, то основы этой новой науки уже созданы, причем стремительно, и идет прогрессивное накопление экспериментального материала. Новый материал поступает потоком, ежедневно в базы данных уходят десятки и сотни новых «экспериментальных точек», которые по принципу обратной связи корректируют методологию новой науки, что приводит к уточнению методов расчета.

Имя этой науки – ДНК-генеалогия. Ее экспериментальные данные – это картина мутаций в нерекомбинантных участках мужской половой хромосомы (на самом деле – и в митохондриальной ДНК, но в этом очерке речь пойдет только об Y-хромосоме, иначе объем его выйдет за пределы допустимого), причем картина мутаций как в Y-хромосомах отдельных людей, так и их групп, популяций. Методология новой науки – перевод динамической картины мутаций в хронологические показатели, во времена жизни общих предков популяций, а на самом деле – общих предков древних родов и племен. То есть фактически производится расчет времен, когда в древности жили эти рода и племена.

Мутации, рассматриваемые в ДНК-генеалогии – это или одиночные (как правило) замены нуклеотидов в ДНК, как, например, аденин на цитозин, или цитозин на тимин, или вставки нуклеотидов, или делеции, или мутации более сложные, при которых ошибка копирующего фермента приводит к переносу целого блока нуклеотидов, тандемного, как его порой называют. Это дает или удлинение серии таких блоков на один (редко – сразу на два-три блока), или их укорачивание. Первые мутации – SNP (Single Nucleotide Polymorphism, или в переводе «одиночные нуклеотидные вариации»), или «снипы», обычно очень стабильны, и их для ДНК-генеалогии отбирают только такие, которые случаются только один раз (два раза – максимум) за историю человечества. Поэтому они являются маркерами родов человечества. Примеры будут даны ниже.

Мутации второго типа – STR (Short Tandem Repeats, или «короткие тандемные повторы») – значительно более быстрые, и происходят в определенных участках, или локусах, или маркерах (это все синонимы) ДНК раз в несколько десятков или сотен поколений. Набор этих маркеров составляет гаплотип, примеры гаплотипов будут даны ниже. Гаплотип – это по сути цепочка чисел, показывающих число повторов в определенных маркерах. Поэтому гаплотипы ДНК выбирают так, чтобы в них таких маркеров было как можно больше (но все-таки чтобы оставаться в рамках практичности), и в ранних работах использовались 6-маркерные гаплотипы, затем 12-маркерные, 17– и 19-маркерные, затем 25– и 37-маркерные, а сейчас работа рутинно ведется с 67– и 111-маркерными гаплотипами (правда, в академических публикациях это обычно от 8 до 17 маркерных гаплотипов). В 67-маркерных гаплотипах, например, одна мутация происходит в среднем за 8 поколений, в 111-маркерных – за 5 поколений.

Например, предковый гаплотип осетин со снипом Z6638 (в гаплогруппе G2a1, о которой речь пойдет ниже) c «возрастом» 1375±210 лет выглядит так:

 

14 23 15 9 15 17 11 12 11 11 10 28 17 9 9 12 11 25 16 21 28 13 13 14 14 11 11 19 21 15 15 16 18 37 38 12 9 11 8 15 16 8 11 10 8 12 10 12 21 22 14 10 12 12 15 8 13 21 22 15 13 11 13 10 11 11 13 30 15 8 16 11 23 27 21 9 11 13 13 11 9 10 12 10 11 12 27 10 12 22 14 11 10 24 15 17 14 23 18 12 15 27 12 21 18 11 14 17 9 12 11

 

А предковый гаплотип карачаево-балкарцев c тем же снипом и в той же гаплогруппе, с «возрастом» 4650±750 лет, но в 67-маркерном формате (111-маркерных гаплотиппов карачаево-балкарцы себе не определяли), имеет вид:

 

14 22 15 10 15 16 11 12 11 12 10 29 17 9 9 11 11 25 16 21 29 13 13 14 14 10 10 20 21 15 15 15 18 36 38 11 10 11 8 15 16 8 11 10 8 12 10 12 21 22 14 10 12 12 15 8 13 21 22 16 13 11 13 10 11 11 13

 

Между этими предковыми гаплотипами – 14 мутаций на первых 67 маркерах. Это очень много, и это разводит их общих предков на 14/0.12 = 117 → 133 условных поколений (по 25 лет каждое), то есть примерно на 3325 лет, и их общий предок жил примерно 4675 лет назад. Но это и есть «возраст» общего предка карачаево-балкарцев гаплогруппы G2a1, к которой относится треть всего народа, точнее, его мужской половины. Иначе говоря, и карачаево-балкарцы, и осетины гаплогруппы G2a1 происходят от одного общего предка, который жил в первой половине III тыс до н. э. Осталось выяснить, где он жил, и это ДНК-генеалогия тоже способна определить. Состояние ответа на сегодняшний день – это историческая Бактрия, область на сопредельных территориях Узбекистана, Таджикистана и северного Афганистана. Именно там современные жители той же гаплогруппы имеют подобные предковые гаплотипы. В формуле выше 0.12 (мутаций на гаплотип за условное поколение) – это константа скорости мутаций для 67-маркерных гаплотипов, стрелка показывает табличную поправку на возвратные мутации. Это упрощенный пример, потому что по двум гаплотипам расчеты обычно не ведут, ведут по десяткам и сотням гаплотипов, если таковые есть в наличии, рассчитывают математические погрешности в определяемых цифрах, и т. д. Здесь только иллюстрируется принцип расчета.

В гаплотипах, приведенных выше, первое число показывает, что в одном из маркеров Y-хромосомы определенная последовательность нуклеотидов повторяется 14 раз. В другом маркере, который здесь показан как следующий, блок нуклеотидов повторяется 23 раза у осетин, и 22 раза у карачаево-балкарцев, и так далее. Чтобы показать, что все это на самом деле четко определено и зафиксировано,[6]добавим, что в первом маркере (под названием DYS393) повторяется четверка нуклеотидов AGAT, то есть аденин-гуанин-аденин-тимин

 

GTGGTCTTCTACTTGTGTCAATAC/AGAT/AGAT/AGAT/AGAT/ AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AT GTATGTCTTTTCTATGAGACATACCTCATTTTTTGGACTTGAGTTC

 

и эти повторы обрамляются уже неупорядоченными последовательностями нуклеотидов в ДНК, как показано выше. Во втором маркере, под названием DYS390, повторяется уже другая четверка, TCTG, то есть тимин-цитозин-тимин-гуанин, которая переходит в четверку TCTA, то есть тимин-цитозин-тимин-аденин, и число повторов складывается (здесь показана последовательности для 22 повторов, как у карачаево-балкарцев):

 

TATATTTTACACATTTTTGGGCCCTGCATTTTGGTACCCCATAA TATATTCTATCTA/TCTG/TCTG/TCTG/TCTG/TCTG/TCTG/TCTA/ TCTA/TCTA/TCTA/TCTATCTA/TCTA/TCTA/TCTA/TCTA/TCTA/ TCTA/TCTG/TCTA/TCTA/TCTA/TCATCTATCTATCTTTCCTTGTTT CTGAGTATACACATTGCAATGTTTTCATTTTACTGTCAC

 

Перечисленные четыре нуклеотида – это язык ДНК, который состоит из этих четырех слов, или четырех букв, при сокращенной записи. Эти нуклеотиды комбинируются парами, и их так и называют – «пары оснований». Они фактически держат двойную спираль ДНК.

Нам эти четверки (а также тройки нуклеотидов, и другие типы повторов) в маркерах ДНК в дальнейшем не понадобятся, это описание мы даем только для того, чтобы показать, что за числами в гаплотипах стоят масштабные исследования, которыми занимаются в мире сотни и тысячи человек.

Гаплотипы ДНК выбирают так, чтобы в них таких маркеров было как можно больше (но все-таки чтобы оставаться в рамках практичности), и в ранних работах использовались 6-маркерные гаплотипы, затем 12-маркерные, 17– и 19-маркерные, затем 25– и 37-маркерные, а сейчас работа рутинно ведется с 67– и 111-маркерными гаплотипами (правда, в академических публикациях это обычно от 8 до 17 маркерных гаплотипов).

В 67-маркерных гаплотипах одна мутация происходит в среднем за 8 поколений, в 111-маркерных – за 5 поколений. Поэтому у 111-маркерных гаплотипов разрешение лучше. Но их определять дороже, чем более короткие, поэтому в академических исследованиях, при постоянной нехватке денежных средств, приходится работать с более короткими гаплотипами. Длинные гаплотипы определяют в коммерческих компаниях, обычно персонально, каждый для себя, и передают, как правило, в общественные базы данных. Сейчас в общественных базах данных – сотни тысяч гаплотипов, и базы прирастают многими гаплотипами ежедневно[7].

Как мы покажем ниже, эти гаплотипы, а именно числа в них, напрямую связаны с хронологией древних миграций людей, переходами людей на новые места, событиями прошлого – войнами, климатическими катаклизмами, эпидемиями, в общем, со всем тем, что так или иначе влияло на численность популяций человека в определенные времена и на определенных территориях. Например, расчеты могут показать, когда древние арии появились на Русской равнине, когда они появились в Индии, Иране, на Ближнем Востоке – потому что эти события приводили к появлению на этих территориях и в те времена общих предков популяций, которые разрастались вплоть до нашего времени, образуя «кусты» гаплотипов со всеми мутациями в них, то есть изменениями чисел в маркерах.

Поскольку уже показано и доказано, что мутации в маркерах происходят в основном (или исключительно) неупорядоченно, то к ним оказалось возможным применять правила и подходы химической кинетики, или биологической кинетики, кому какой термин больше нравится – суть одна. И снипы, и маркеры мутируют по законам кинетики первого порядка, других закономерностей пока не обнаружено. Это означает, что каждому маркеру свойственна определенная константа скорости мутации, и каждому гаплотипу (состоящему из набора маркеров) – тоже свойственна определенная средняя константа скорости мутации, равная сумме констант скоростей мутаций отдельных маркеров. Поэтому чем древнее общий предок популяции, тем больше мутаций накапливается в гаплотипах его потомков по сравнению с ним, тем больше поколений (и лет) отделяет современных потомков от их общего предка, и это число поколений (и лет) рассчитывается методами ДНК-генеалогии. Как это делается, тоже будет показано ниже на многих примерах.

ДНК-генеалогия базируется на четких правилах, которых можно насчитать четырнадцать.

Положение первое – к генетике ДНК-генеалогия прямого отношения не имеет. Хотя в определенной части ДНК-генеалогии рассматривают и гены, например, при рассмотрении всего генома человека, но это – специальная часть ДНК-генеалогии, и этого здесь не будет. ДНК – это не только гены. Гены вообще занимают только 1,9 % последовательности ДНК. Остальные 98,1 % – длинные участки, так называемые «никчемные». Генов там нет (это подробно разобрано в статье – Клёсов, 2012a).

В ДНК есть протяженные последовательности повторяющихся нуклеотидов, в которых, повторяю, генов нет, и эти последовательности детально копируются при передаче наследственной информации от отца к сыну. Я специально пишу «от отца к сыну», потому что в данном очерке речь идет только о «мужской» наследственной информации, передаваемой с мужской половой Y-хромосомой. У женщин ее, этой хромосомы, нет.

«Никчемными» эти негенные последовательности ДНК назвали по незнанию, и это название уже уходит в прошлое. По мере исследований, оказалось, что эти последовательности хранят массу информации и не только «генеалогического» характера. Более того, оказалось, что они, эти «никчемные» участки, содержат сотни, если не тысячи крошечных генов РНК, кодирующих так называемые микро-РНК, длиной всего пару десятков нуклеотидов каждый, и которые регулируют синтез белков. Но это – предмет другого повествования.

Эти негенные участки ДНК в мужской Y-хромосоме, одной из 23 хромосом, которые доставляются сперматозоидом в организм будущей матери, копируются от отца к сыну, поколение за поколением. Поскольку у матери такой хромосомы нет, то сын наследует ее только от отца. Хромосомы сплетаются с материнской ДНК и образуют новую комбинированную молекулу ДНК, в которой хромосомы отца и матери перетасовываются. Перетасовываются все, кроме мужской Y-хромосомы.

Так и получается, что отец передает сыну эту Y-хромосому интактной, строго скопированной со своей. А свою Y-хромосому он получил от своего отца. Тот – от своего. И так далее, на тысячи, десятки тысяч и сотни тысяч лет вглубь, назад, к далеким предкам современных людей и к предкам тех далеких предков.

Важное примечание. В антропологии принято считать, в соответствии с базовыми понятиями, парадигмой антропологии, что сотни тысяч лет назад людей не было. Были палеонтропы, архантропы, неандертальцы, эректусы, другие гоминиды. Однако наши предки были, как их ни называть. Они были и десятки, и сотни тысяч лет назад, и миллионы лет назад. От них, «приматов», мы и наследуем гаплотипы и гаплогруппы, пусть в значительной степени измененные, мутированные, иногда потерявшие целые куски.

Таким образом, аргументы, что тогда-то давно не было предков современного человека, в принципе неверны. Они были, но просто или не обнаружены антропологами (что вполне возможно), хотя и были на рассматриваемой территории, или они были представлены минорной долей гоминидов и прочих «приматов», и при изучении последних просто не встречались, проскочили сито антропологов, весьма крупноячеистое. Или определение, используемое антропологами, слишком жесткое и не отражает значительно более сложной истории происхождения человечества.

Если бы Y-хромосома так и передавалась из поколения в поколение действительно неизменной, толку для генеалогии от нее было бы мало. Но неизменного ничего в мире нет, особенно когда речь о копировании. Копирования без ошибок не бывает. В том числе и копирования Y-хромосомы.

Отсюда второе положение – время от времени при копировании Y-хромосомы в копии проскакивают ошибки. Фермент под названием ДНК-полимераза (на самом деле вместе с целым набором молекулярных инструментов) или просто ошибается и делает некоторые участки ДНК короче или длиннее, удлиняя или сокращая повторы нуклеотидов, или «ремонтирует» поврежденные участки и в ходе «ремонта» удаляет повреждение (эта операция называется «делеция») или «вшивает» новый нуклеотид (называется «вставка», или «инсерт»). То, что удалось отремонтировать, в мутации не попадает, как будто мутации и не было. Что не удалось – передается сыну при рождении. Если родилась дочь, то Y-хромосома не передается. Если только дочери, или детей нет – Y-хромосома терминируется, вместе с мужской наследственной линией.

Мутации, которые интересуют ДНК-генеалогию, бывают двух типов – или изменение числа повторов, тандемов (STR), или «точечные», одно– или несколько-нуклеотидные (SNP).

Оказалось, что многие повторы нуклеотидов находятся у разных людей в одних и тех же участках Y-хромосомы. Эти участки уже специалистами пронумерованы, классифицированы, сведены в списки. Они получили название «маркеры». Набор маркеров, точнее, повторов в них, называется «гаплотип». Уже известных маркеров – более тысячи. Они, как правило, одни и те же у всех людей на Земле. Они отличаются только числом повторов, что вызвано теми самыми ошибками ферментов при копировании из поколения в поколение. Внимательное рассмотрение маркеров и гаплотипов позволило сделать вывод, что все люди на Земле произошли от одного предка.

Итак, положение третье : все люди – родственники, они все происходят от одного предка. Этот предок оказался древнее, чем предполагалось раньше, но он был. Еще недавно считалось, что он жил примерно 70 тысяч лет назад, потом 120 тысяч, а теперь он уже уходит глубже 200 тысяч лет назад, постепенно приближаясь к общему предку с неандертальцем 300–500 тысяч лет назад. Примерно такое время понадобилось, чтобы получить то расхождение гаплотипов по мутациям, какое наблюдается у всех живущих ныне людей. Последнее углубление по времени произошло потому, что в Африке нашли необычные ДНК-генеалогические линии, которые отличаются от всех людей на Земле, в том числе и от остальных африканцев, но гаплотипы хоть и отдаленно, но похожи на те, что есть у всех нас. Значит, общий предок был один и тот же, только очень древний.

Положение четвертое – гаплотипы изображают в виде числа тандемов, или повторов, по каждому маркеру, выбранному из десятков и сотен. В англоязычной литературе, как уже говорилось, их называют STR, или Short Tandem Repeats. Самый простой и короткий гаплотип из тех, которые рассматривает ДНК-генеалогия, состоит из пяти или шести маркеров. Например, у носителей гаплогруппы G2a, которая на западном и центральном Кавказе основная по численности и составляет около половины мужского населения, базовый (или предковый) 6-маркерный гаплотип, в той записи, которую обычно приводят в научных публикациях, особенно в устаревших, такой:

 

15 12 22 10 10 14

 

Он показывает число повторов нуклеотидных участков в маркерах, которые обозначают соответствующими индексами 19, 388, 390, 391, 392 и 393. В первом маркере (номер 19) было найдено 15 повторов определенной последовательности нуклеотидов. Во втором – 12 повторов уже другой последовательности и так далее. При передаче этого гаплотипа от отца сыну с вероятностью примерно одна сотая, или один процент (то есть в среднем у одного на сто рождений) может произойти мутация, например, такая:

 

15 12 21 10 10 14

 

А может произойти и такая –

 

16 12 22 11 10 14

 

или любая другая, только одни мутации в одних маркерах происходят чаще, в других – реже.

 

У носителей той же гаплогруппы (рода) G2a, но другой ветви (племени, или, как называют в ДНК-генеалогии, субклада) G2a2b2a-P303

 

15 12 23 10 11 14

 

У носителей R1a-Z93-L342.2-Z2123, распространенной у карачаево-балкарцев

 

15 12 25 11 11 13

 

У носителей гаплогруппы R1a-Z280, типичной для современных этнических русских,

 

16 12 25 11 11 13

 

у носителей R1a-L342.2, наиболее полно соответствующих степным ариям 3-го тыс. до н. э.,

 

16 12 25 11 11 13

 

у скифов из раскопок в Минусинской котловине, с датировками 3800–3400 л.н.,

 

16 12 25 11 11 13

 

в высших кастах Индии (R1a-L342.2-L657)

 

16 12 25 11 11 13

 

Мы видим, что даже короткие, 6-маркерные гаплотипы являются вполне информативными, и позволяют сразу распознать представителей гаплогруппы G2a, представителей арийских народов и их потомков – скифов, восточных славян, состав высших каст в Индии (гаплогруппы R1a, которая там доминирует). Более протяженные гаплотипы, вплоть до 67-и 111-маркерных, позволяют уточнить картину, выявить более недавние ДНК-генеалогические линии, определить их датировку. Но суть от этого принципиально не меняется.

В среднем мутация в таких 6-маркерных гаплотипах происходит, как было найдено, в среднем раз на сто рождений мальчиков. Если перевести во времена, то константа скорости мутации в 6-маркерных гаплотипах равна 0.0088 мутаций на весь гаплотип за 25 лет.

Отсюда следует положение пятое – по числу мутаций в гаплотипах можно определять возраст гаплотипа, то есть время, прошедшее от общего предка этого гаплотипа до его сегодняшних потомков. Поскольку сыновья сохраняют гаплотип отца, переданный по наследству, и мутации в этом гаплотипе проскакивают в среднем только раз примерно в 3100 лет (6-маркерный гаплотип) или раз в 1300 лет (12-маркерный гаплотип), или раз в 125 лет (111-маркерный гаплотип), то даже через 5000 лет у потомков сохранится 23 % исходного 6-маркерного гаплотипа, без изменений. То есть в списке из 100 гаплотипов потомков – 23 гаплотипа будут такими же, какой был у предка 5000 лет назад. Это если рассматривать 6-маркерные гаплотипы. При рассмотрении 12-маркерных гаплотипов те же 23 % гаплотипов предка сохранятся через 88 поколений, или 2200 лет.

Так что и через тысячелетия можно определить гаплотип предка. И по его виду можно узнать, из каких краев предок пришел, сравнив вид гаплотипа с гаплотипами по территориям, и с доступными ископаемыми гаплотипами.

 

Положение шестое – гаплотипы не указывают на этносы, это совершенно разные понятия. Гаплотипы указывают на древние рода, племена, которые намного старше этносов. С тех древних времен гаплотипы давно разошлись по разным территориям, на которых потом, через тысячелетия сформировались этносы. Например, 6-маркерный предковый гаплотип племени G2a1a1, основной у грузин (с немногими мутациями, набежавшими за тысячелетия)

 

15 12 22 10 10 14

 

есть и у осетин (дигорцев и иронцев), и у шапсугов, и у черкесов (адыгов), и у абхазов, с некоторыми вариациями, потому что общий предок в каждом этносе жил в разное время. К одним этот род пришел недавно и бурно размножился, как у осетин, у других был со стародавних времен, у третьих род почти уничтожили враги, осталось мало, и пропорции родов в этносе качнулись в другую сторону. Конкретные цифры будут даны ниже, по этносам. Но все они, потомки гаплогруппы G и племени G2a1a1, братья, один и тот же род, все от одного и того же предка-патриарха, хотя доля этого рода у всех сейчас разная. Если у грузин его 32 % (еще 10 % – племени G2a3b1, и еще несколько процентов племени G2a*), то у осетин-дигорцев 55 %, у осетин-иронцев 72 %, у карачаевцев 29 %, у абхазов 27 %, у черкесов 14 %, у шапсугов всего 1 %.









Не нашли то, что искали? Воспользуйтесь поиском гугл на сайте:


©2015- 2018 zdamsam.ru Размещенные материалы защищены законодательством РФ.